BACKGROUND: The INTERCEPT Blood System (Baxter Healthcare Corp.) for platelets (PLTs) uses amotosalen-HCl (S-59) in conjunction with ultraviolet A (UVA) light to inactivate contaminating pathogens by modifying the nucleic acids of pathogens. The success of this photochemical treatment (PCT) process can be documented indirectly with a high-performance liquid chromatography assay measuring the photodegradation of amotosalen and measurement of the UVA light dose delivered by the illumination system. STUDY DESIGN AND METHODS: To develop an assay that documents the success of PCT directly on the effector molecule DNA, the effect of PCT on PLT-derived mitochondrial DNA (mtDNA) was examined. mtDNA-specific polymerase chain reaction (PCR) assays were tested with regard to their susceptibility for PCT, their reliability in terms of PCR performance, and the absence of polymorphic sites in primer hybridization loci. RESULTS: Suitable PCR amplification targets were found in the regions of 16S rDNA, cytochrome c oxidase I, and cytochrome c oxidase III of mitochondria. Amplicon sizes between 868 and 1248 bp gave consistent signals before PCT and complete inhibition of the PCR signal after PCT. Amplicons of less than 300 bp were found to be transparent to PCT. CONCLUSION: Based on PCT-mediated mtDNA modifications in PLTs, a PCR inhibition assay was established with a large amplicon documenting the success of PCT and a small amplicon serving as an internal control.

DNA can be sequenced by a chemical procedure that breaks a terminally labeled DNA molecule partially at each repetition of a base. The lengths of the labeled fragments then identify the positions of that base. We describe reactions that cleave DNA preferentially at guanines, at adenines, at cytosines and thymines equally, and at cytosines alone. When the products of these four reactions are resolved by size, by electrophoresis on a polyacrylamide gel, the DNA sequence can be read from the pattern of radioactive bands. The technique will permit sequencing of at least 100 bases from the point of labeling.

An analysis of nearest neighbour dinucleotide frequencies and the level of DNA methylation in animals strongly supports the suggestion that 5-methylcytosine (5mC) tends to mutate abnormally frequently to T. This tendency is the likely cause of the CpG deficiency in heavily methylated genomes.

The outer membrane lipoprotein is the most abundant protein in an E. coli cell. Its structural gene (Ipp) was cloned into a lambda phage vector and the nucleotide sequence of a DNA fragment of 814 bp encompassing the Ipp gene was determined. The promoter region of the gene was found to have the following features. First, a segment of 261 bp preceding the transcription initiation site (-1 to -261) has a very high AT content of 70%, in contrast to 53% for the mRNA region of 322 bp, 44% for a segment of 127 bp after the transcription termination site and 49% for the average AT content of the E. coli chromosome. Second, in particular, of the first 45 bp upstream from the transcription initiation site (-1 to -45), 36 bases (80%) are A or T. Third, there is a heptanucleotide sequence homologous to the "Pribnow box," eight bases apart from the transcription initiation site. Fourth, a sequence homologous to the "RNA polymerase recognition site" exists on both strands between positions -27 and -39. Finally, there is a long dyad symmetry centered at the transcription initiation site.

Escherichia coli (A)BC excinuclease is the major enzyme responsible for removing bulky adducts, such as pyrimidine dimers and 6-4 photoproducts, from DNA. Mutants deficient in this enzyme are extremely sensitive to UV and UV-mimetic agents, but not to oxidizing agents, or ionizing radiation which damages DNA in part by generating active oxygen species. DNA glycosylases and AP1 endonucleases play major roles in repairing oxidative DNA damage, and thus it has been assumed that nucleotide excision repair has no role in cellular defense against damage by ionizing radiation and oxidative damage. In this study we show that the E. coli nucleotide excision repair enzyme (A)BC excinuclease removes from DNA the two major products of oxidative damage, thymine glycol and the baseless sugar (AP site). We conclude that nucleotide excision repair is an important cellular defense mechanism against oxidizing agents.

The chicken c-myc 5'-flanking sequence has previously been shown to bind multiple proteins present in undifferentiated and differentiated red blood cells. In this report the protein binding to one specific region within a hypersensitive site approximately 200 base pairs upstream of the start of transcription has been analysed in detail. Using a combination of a modified agarose gel retardation assay with O-phenanthroline-copper footprinting in situ, missing contact point and methylation interference techniques, two proteins were found to bind to overlapping sequences within 180-230 bp upstream of the start of transcription. One protein resembles the transcription factor Sp1, the other is a protein which binds to three regularly spaced repeats of the core sequence CCCTC. This CCCTC-binding factor was termed CTCF. It requires additional sequences outside the three recognition motifs for tight binding. CTCF was purified to near homogeneity by sequence-specific DNA chromatography. The approximate molecular weight of the CTCF was estimated to be 130,000. Removal of 110 bp sequence binding both CTCF and Sp1-like proteins leads to a 4 to 8-fold increase in transcription of stably transfected c-myc fusion constructs in chicken embryonic fibroblasts, suggesting that the CTCF is likely to be one of multiple nuclear factors involved in the transcriptional regulation of the chicken c-myc gene.

The primary sequence of the principal spacer region in X. laevis oocyte 5S DNA has been determined. The spacer is AT-rich and comprises half or more of each repeating unit. The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T). The spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (A2) which is variable in length in different repeating units, flanked by regions (A1, A3, B1) which are relatively constant in length. The A2 region consists, on the average, of 5-6 tandem copies of the oligonucleotide CAAAGTTTGAGTTTT; variation in the redundancy of this oligonucleotide accounts for much of the repeat length variation in the genomic 5S DNA. Most copies of this oligonucleotide are identical, although several differing by 1 or 2 nucleotides have been detected in plasmid-cloned 5S DNA fragments. Regions A1 and A3 comprise a linear array of similar, but not identical, oligonucleotides; most repeating units contain very similar A1 and A3 sequences. Region B1 is a sequence of 49 nucleotides immediately adjacent to the 5' terminus of the 5S rRNA sequence. It is GC-rich, much less repetitive than the remainder of the spacer and contains several palindromes, but no regions of dyad symmetry. This sequence is identical in all six of the single cloned repeating units of 5S DNA analyzed.

Sequence analysis of 236 promoters recognized by the Bacillus subtilis sigma A-RNA polymerase reveals an extended promoter structure. The most highly conserved bases include the -35 and -10 hexanucleotide core elements and a TG dinucleotide at position -15,-14. In addition, several weakly conserved A and T residues are present upstream of the -35 region. Analysis of dinucleotide composition reveals A2- and T2-rich sequences in the upstream promoter region (-36 to -70) which are phased with the DNA helix: An tracts are common near -43,-54 and -65; Tn tracts predominate at the intervening positions. When compared with larger regions of the genome, upstream promoter regions have an excess of An and Tn sequences for n > 4. These data indicate that an RNA polymerase binding site affects DNA sequence as far upstream as -70. This sequence conservation is discussed in light of recent evidence that the alpha subunits of the polymerase core bind DNA and that the promoter may wrap around RNA polymerase.